Archivos
Categorías
Artículos de Interés

Ojalá pierda el puto Atleti

paleti
Y volver a cagar.

– Sacaron un resultado de mierda en la ida, así que creo que sí, que hoy los van a eliminar por muchas hostias y navajazos que metan. Ni sacando a los asesinos del Frente (ya sabéis, los que habían expulsado) se clasifican. Y cuando acabe el partido, ojalá se derrumbe el estadio y mueran todos. Pero esto lo digo para ahorrarles el disgusto, ¿eh? Porque soy una gran persona.

– Tata Ancellotti: Ya sabíamos que el Tata, el señor ése que entrenó a la Far$a el año pasado, era maricón, pero lo hemos acabado de confirmar en una reveladora entrevista que ha concedido a la web de la FILFA. Ojo a las declaraciones: En un club como el Barcelona el técnico termina descubriéndose rápido ante el plantel, porque además pesan las características distintas de los rivales. Entonces, cuando uno rota para que todos se sientan cómodos y motivados, eso se va al diablo ante el primer partido importante. Ahí el jugador dice ‘la realidad es ésta, la rotación es linda pero en los partidos cruciales, el equipo será éste’. Vamos, que se tragó todo el lefote de las vacas sagradas. Lo malo es que recuerda demasiado a… sí, exacto a ése. Como dice CR7, ¡¡hay que joderse!! En fin, siempre recordaremos al Tata por llamar Barra Brava al gordaco de Lu Martín.

– Necesitamos una buena guerra nuclear. Vean si no lo que dice esta encuesta. ¿Serán estos los mismos que votan a Potemos? ¿Se puede ser podemista y casillista a la vez? Vladimir, pulsa el botoncito.

Russian President Vladimir Putin pushes
«¡Con gusto!»

¡¡¡BUUUUUUUUUUUUUUUMMMMMMMMUUMMMM!!!

Share

212 comentarios para “Ojalá pierda el puto Atleti”

  • 1
    AnG-L says:

    Después de varios años, el socio no domina bien su poder. Hoy los paléticos se levantarán con energías renovadas y más motivados que nunca. Sólo falta que Miki diga que le va a meter pelas a la eliminación del paleti.

  • 2
    madridsXXI says:

    En lo de la entrevista al Tata, es conmovedor cuando dice: «el jugador dice (…) el equipo es este». Hasta cuando el enano lo ha jodido completamente, le dice «el jugador» y no lo llama por su nombre. Pobre hombre.

    Hay que tener poco orgullo, poca vergüenza y nula autoestima para que después de que un jugador te diga que te va a hacer tu trabajo, y tú eres un adorno en el banco, para no o bien echar al jugador, o largarte tú en ese mismo momento.

  • 3
    Sobibor says:

    Épico final de entrada. Viva Rusia.

    Sobre la encuesta de Maraca, no hay que extrañarse. España es un país de mierda, y es normal que se admiren a algunos tíos mierda.

  • 4
    Exiliado says:

    Sobibor: Sobre la encuesta de Maraca, no hay que extrañarse. España es un país de mierda, y es normal que se admiren a algunos tíos mierda

    Que es un sondeo del Maaaaaaarca.

  • 5
    Sobibor says:

    Podemista y casillista se puede ser perfectamente. Podemista y madridista ya lo veo más difícil.

    Si alguien es fan de The Coletor y le preguntas sobre fúrbol, veo bastante probable una respuesta del tipo: «Uy yo madridista no, en realidad soy algo antimadridista, pero en cambio Casillas me cae bien, se le ve un tío muy humilde y blablabla».

  • 6
    Exiliado says:

    Flanker: No me gustan las negras, salvo algunas con rasgos etíopes, somalíes o como se diga.

    O sea las niloticas. A tu lista hay que anyadior las Masais y las Tutsis. Tienen rasgos mucho mas europeos con nariz fina y lacbios delgados. Y tampoco tienes esos culos enormes que tienen muchas africanas «normales».

    Una vez mientras hacia cola en la panaderia oigo una voz de ninya detras mio pero proveniente de mas arriba que mi oreja. Pensé que alguien tenia a su hija en brazos pero en ese caso la cabeza de la niña (en un sitio cerrado no la llevas sobre los hombros) está a la altura de la del padre lo que queria decir que era bastante mas alto que yó (1m87) lo cual no es frecuente. Extranyado me giré y era una negra algo asi como 1m95, esbelta y una verdadera belleza. A mi me pasa como a ti las nagras «normales» no suelen ponerme porque sus rostros (mas que nada esos labios y narices abultados) me «desconectan» pero esa era una tutsi o una masai de rasgos mucho mas europeos y le hubiese dado sin compasion.

  • 7
    Blue says:

    Hoy es día susceptible para tragarse el partido del Paleti por televisión, todo sea por la posibilidad de que palmen…

  • 8
    Exiliado says:

    madridsXXI: Hay que tener poco orgullo, poca vergüenza y nula autoestima

    O tener la cuenta bancaria en numeros rojos.

  • 9
    madridsXXI says:

    Blue: Hoy es día susceptible para tragarse el partido del Paleti por televisión

    Aün no llego a esos niveles de degeneración. Pasaré mi tiempo viendo alguna peli de orgías con enanos, disfraces nazis y látigos. Que algunos aún tenemos algo de rectitud moral.

  • 10
    Tenore says:

    Al menos el Tata dice que intentaba rotar en los partidos de chichinabo. Además, si lo que quiere decir es que en un equipo top, en los encuentros importantes van a jugar las estrellas, es lo que tiene que pasar si todos rinden en un nivel óptimo, que se impongan los mejores. Llevado con rigor, lo que dice no me parece tan mal.

    En cuanto a la encuestita, ya quisiera Casillas tener los cojones, iniciativa y ética de trabajo de los otros dos. El votante online medio tiene un nivel que ni el más selecto «tripitidor» de cuarto de la ESO, oiga.

  • 11
    AnG-L says:

    No se puede tripitir cuarto de ESO, no? Creo recordar que sólo se puede repetir una vez y luego palante.

  • 12
  • 13
    Tostador says:

    Han encontrado los restos de Cervantes. Que le hagan la autopsia e investiguen dónde estaban los del Frente Atlético el 22 de abril de 1616.

  • 14
    Mr Bungle says:

    Belén Esteban derrocha elegancia, clase, educación y saber estar comparada con lo de Susana Díaz ayer.
    Acojonante el nivel de los políticos con posibilidades y pretensiones de ser presidentes de España los próximos años.

  • 15
    El Socio says:

    Exiliado: Que es un sondeo del Maaaaaaarca.

    No, es de Adecco.

  • 16
    El Socio says:

    Mr Bungle: Belén Esteban derrocha elegancia, clase, educación y saber estar comparada con lo de Susana Díaz ayer.

    Yo tampoco la vi tan mal el rato que lo puso. ¿Dijo alguna barbaridad gorda?

  • 17
    Mr Bungle says:

    El partido Paleti – Leverkusen de hoy no es apto para estómagos delicados. Será algo así como una pelea clandestina de perros de presa dopados, narrada por unos comentaristas que ensalzarían un triunfo costroso como si del desembarco de Normandía se tratase mientras que llorarían y clamarían venganza como madres gitanas con el hijo muerto a navajazos en brazos si pierde el Paleti.

    No sé, me decantaré por algo menos gore, como Holocausto Caníbal, Martyrs o El ciempiés humano 2.

  • 18
    Mr Bungle says:

    El Socio: ¿Dijo alguna barbaridad gorda?

    Barbaridad barbaridad, no, aparte de la cutre pose de «Andalucía soy yo». Pero gastó unos modales que ni las verduleras del rastro de Tetuán cuando se pelean cuando una ha invadido con su puesto dos centímetros del sitio de la otra.

  • 19
    El Socio says:

    Cher Lloyd, nueva putita teen. Va de sexy, pero yo nomelafo.

    https://youtu.be/LPgvNlrBfb0

  • 20
    El Socio says:

    Mr Bungle: No sé, me decantaré por algo menos gore, como Holocausto Caníbal, Martyrs o El ciempiés humano 2

    😀

  • 21
    Hildebrando says:

    Pues yo hoy me voy a ver los 2 partidos en el Bohemen con Hildebranda y una amiga suya que está moi boena, mi cervecita y a disfrutar. Si gana el Farsenal que se joda el Mónaco, pero si pierde as usual el descojone va a ser monumental, por no hablar del placer de ver las contras del Leverkussen.

  • 22
    Hildebrando says:

    El Socio: Cher Lloyd, nueva putita teen. Va de sexy, pero yo nomelafo.

    Dios mío… ciento cuarenta y tantos millones de views… esa puta mierda! Joder, espero que la ira de Wagner caiga sobre todos ellos!

  • 23
    El Socio says:

    Hoy voy a hablaros del bonito e inocente mundo de las piscinas infantiles. Yo no sé si se venden mucho o poco, pero parece obvio que a los fabricantes ven la necesidad de estimular la compra introduciendo en las fotos del producto la figura de un progenitor, normalmente una tía cachonda que representa una madre o hermana.

    Veamos por ejemplo este modelo con animalitos de la selva, en el que se bañan dos alegres hermanos bajo la atenta mirada de la mami, a quien el parto le ha sentado estupendamente.

    http://mlb-s2-p.mlstatic.com/p.....2012-O.jpg

    Si el calor aprieta, una piscina con techo es ideal. Y nada de salir con caniseta, que agobia mucho. Mejor en bikini.

    http://i.sport-intex.ru/u/a5/5...../-/326.jpg

    Si está pegando de verdad, ¡la mami puede meterse en la piscina directamente!

    http://i198.photobucket.com/al.....g~original

    Papá también se puede unir, no es cuestión de dejar a la señora sola.

    http://santos.nexolocal.com.br.....9756/1.jpg

  • 24
    Blue says:

    Hablando de paletismo, salió una columna de opinión en la web de la BBC (el canal de tele británico, no la delantera del Madrid) en donde se denunciaba una campaña del periódico MARCA en contra de Bale (algo que es un hecho irrefutable), y los paletos de MARCA sacan un editorial respondiendo a la BBC, criticándola e intentando ridiculizarla.

    ¡¡¡ El MARCA dando lecciones a la BBC !!!

    Dios mío, qué animalicos estos del Macarra… dan hasta lástima.

  • 25
    El Socio says:

    Hildebrando: Dios mío… ciento cuarenta y tantos millones de views…

    Jaja, entonces no mires cuántas lleva los de Milita Cyrus.

  • 26
    Mr Bungle says:

    Demi Lovato se ha rapado un lado de la cabeza:
    http://assets.nydailynews.com/.....-1-web.jpg
    Puta.

  • 27
    Mr Bungle says:

    Yo ya no puedo mirar las piscinas esas de plástico de la misma manera desde que me descargué «Omar’s Slippery Anal Poundings»

  • 28
  • 29
    El Socio says:

    Mr Bungle: Puta.

    This. Y seguro que traga.

  • 30
    Sobibor says:

    El Socio: Va de sexy

    En verdad va de «malota». Tatuajito por aquí, pose de gamberrilla por allá, pero un casto e inocente «Shhhhh» cada vez que le toca decir «shit», que al final es un vídeo para todos los públicos.

  • 31
    geodotto says:

    El Socio: Cher Lloyd

    Parece salida de mara nicaragüense.
    http://static.idolator.com/upl.....15;450.jpg

  • 32
    El Socio says:

    geodotto: Parece salida de mara nicaragüense.

    Necesita tratamiento Lex Steele. Lo malo es que se acostumbrará enseguida.

  • 33
    El Socio says:

    Mr Bungle: “Omar’s Slippery Anal Poundings”

    ¿Tu mujer ve esas cosas contigo?

  • 34
    geodotto says:

    Mr Bungle: Demi Lovato se ha rapado un lado de la cabeza:

    Símbolo de la decadencia de Occidente.
    Putin, do your job.

  • 35
    AnG-L says:

    Es cosa mía o las bicicletas cuestan una auténtica exageración de dinero? Y encima hay retrasados mentales que dicen que por menos de 500 euros todo es mierda.

  • 36
    Lord Jim says:

    El Socio: Más diversión y estilo al lado de los peques:

    Has sacado a la luz un nuevo conceto.

    MILFPs, Milfs piscineras.

    Vamos como Neymar pero que estén bien buenas, je.

  • 37
    geodotto says:

    Mr Bungle: que me descargué

    Un saludo a Wert

  • 38
    Flanker says:

    Exiliado: O sea las niloticas.

    Sastamente, iba a utilizar ese mismo palabro. Son negras que están, por lo general, bastante jamonas, alejándose de los típicos rasgos negroides de narices y labios que echan para atrás, y esos culos grotescos, qué ascooo, 😀

    http://dontstoptravelling.blog.....ca-ii.html

  • 39
    El Socio says:

    AnG-L: Es cosa mía o las bicicletas cuestan una auténtica exageración de dinero?

    Onvre, en el Cortinglés por 80 lauros creo que puedes comprarte una de montaña básica.

  • 40
    AnG-L says:

    Tengo la más barata del decartón, pero me queda una miaja pequeña, y no la fabrican como mis condones, talla XL.

  • 41
    El Socio says:

    Ola ke asei, somos expertos en felicidad.

    http://www.elmundo.es/espana/2.....b4571.html

    Que los metan en una fragoneta y los despeñen por un acantilado, por favor.

  • 42
    madridsXXI says:

    AnG-L: hay retrasados mentales que dicen que por menos de 500 euros todo es mierda.

    Sí, sí. Vaya gilipollas. Es como decir que pagar más de 10 euros por una comida, teniendo las telepizzas por todas partes vale la pena.

    Una guerra tenían que haber vivido.

  • 43
    El Socio says:

    No son putes, lo hacen por necesidá.

    http://politica.elpais.com/pol.....87258.html

  • 44
    AnG-L says:

    madridsXXI, como los mourinhistas habéis perdido gran parte del cerebro, te lo explico.

    Una bici de lo más barato sirve exactamente igual y te va a dar un rendimiento casi igual que una bici que te cueste varias veces más. Y más aún para el uso que le da la gran mayoría de los pijoteros ciclistas, muchos de ellos fondones, gordos, y deportivamente incapacitados. Lo mismo que las amas de casa que van a hacer la compra en aston martin.

    Que te vas a meter en competiciones o mierda similar, pues entonces gástate bien el dinero, claro. Pero dejarse lo que cuesta una moto para luego ser humillado por una bici mala del decathlon, pues es ridiculé.

    Aparte, telepizza es mierda. Dominos mejor relación cantidad/precio. Y rumanonapolitanos del equinoccio mejores pizzas.

  • 45
    AnG-L says:

    El socio: No son putes, lo hacen por necesidá.

    Está mal el artículo. Dice que hay un 40% de fijos, cuando en realidad son todos multinicks de Vader.

  • 46
    Flanker says:

    El Socio: lo hacen por necesidá

    Porque son unas putas de cuidado. Montoro, toma nota, pon las zorras a cotizar, 😀

    http://sp3.fotolog.com/photo/5.....2937_f.jpg

  • 47
    Flanker says:

    AnG-L: Una bici de lo más barato sirve exactamente igual y te va a dar un rendimiento casi igual que una bici que te cueste varias veces más.

    Acabas de negar de un plumazo el weltanschauung del Mandril. Cambia de equipo a la mayor brevedad posible, 😀

  • 48
    El Socio says:

    Flanker: Porque son unas putas de cuidado.

    http://www.fansdelmadrid.com/w.....efalta.mp3

  • 49
    geodotto says:

    AnG-L: Una bici de lo más barato sirve exactamente igual

    Eso decía un amigo mío, que para dar dos paseos igual de valía cualquier bici. Hasta que se le partió una por una mala soldadura del cuadro (y él pesa 70 kg.).

  • 50
    El Socio says:

    Flanker: Acabas de negar de un plumazo el weltanschauung del Mandril.

    Yo creo que no has entendido lo que quiere decir.

  • 51
    El Socio says:

    Pablemos se quiso follar a la Cifu. Está pasando.

    http://www.periodistadigital.c.....exta.shtml

  • 52
    AnG-L says:

    Con bici de lo más barato me refiero a alguna ligeramente fiable, no de aliexpress. En Everis hubo un año que por navidad regalaron bicis, y eso se veía a la legua que no valía ni para hacer arte moderno.

  • 53
    Daniel says:

    AnG-L: En Everis hubo un año que por navidad regalaron bicis, y eso se veía a la legua que no valía ni para hacer arte moderno.

    Sí, mi hermano pilló una y creo que aún está sin estrenar.

  • 54
    Vader says:

    AnG-L: en realidad son todos multinicks de Vader

    Para ver como está el ganao no hace falta loguearse.

  • 55
    Vader says:

    Hostias, el último youtube de Luis Calles está narrado por Carlitos Alcántara.

    Siempre creí, y vosotros deberíais hacer lo mismo.

  • 56
    geodotto says:

    El Socio: Pablemos se quiso follar a la Cifu.

    Y más de la mitad de los comentaristas de aquí.

    Yo no. Aclaro.
    La Cifu no me va.

  • 57
    Van der Sir says:

    Sobibor: Podemista y madridista ya lo veo más difícil.

    Un saludo a Mandinga que seguro nos lee.

  • 58
  • 59
    Flanker says:

    AnG-L: Con bici de lo más barato me refiero a alguna ligeramente fiable, no de aliexpress.

    Justamente lo que entendí.

    Me imagino que una bici por menos de 200 pavos no es en absoluto recomendable, aquí comentan que por menos de 250, aunque hay gente que dice estar contenta con la comprada en centros comerciales.

    http://www.todomountainbike.es.....omprar-una

  • 60
    Perroladilla says:

    CutrAng-L, ya que vas a comprarte una puta pedazo de mierda con pedales, vete a El Corte Inglés, que sus bicis marca blanca son bastante mejores que las del Decathlon.

  • 61
    Vader says:

    geodotto: La Cifu no me va.

    Cuando derroche erótica del poder tras las elecciones ni tú te resistirás. Esa tía es una bomba, no jodas.

  • 62

    Van der Sir: Un saludo a Mandinga que seguro nos lee.

    Es verdad, Mandinga creo que era el prototipo de cerebro predipuesto perfectamente para votar a Podemos. Aunque igual se ha puesto a trabajar …

  • 63
    Flanker says:

    El gendarme de Albacete: y tened mucho cuidado por esas carreteras de dios

    Y una conductora, solo faltó que le dijera que no la acosara. Hay muchas tías como ésa.

  • 64
    Flanker says:

    Vader: Esa tía es una

    Feixista.

  • 65

    ¿que tal, Vader?. Este año creo que va a ir mejor lo del día del padre. Dependerá de las señoritas ….

  • 66
    Perroladilla says:

    Vader: Cuando derroche erótica del poder tras las elecciones ni tú te resistirás. Esa tía es una bomba, no jodas.

    Estoy con Geo, esa tía tiene cara de travelo, como Tania Sánchez ¿ Mi diagnóstico? Ni con un palo.

  • 67
    Vader says:

    El gendarme de Albacete: Aunque igual se ha puesto a trabajar …

    Jajaja.

    Yo conocí a uno que decía, entre otras historias, que estaba a favor de que se jugase la final de Copa en el Bernabéu, por «… recibir a dos grandes equipos en nuestra ciudad y blablabla…».
    Lo mandé a tomar por culo, qué remedio, pero este tío no era así hace un año, fue a raíz de hacerse Pablista cuando le lavaron el cerebro, rollo secta.

    Supongo que debe haber alguna predisposición genética para que te pasen estas cosas.

  • 68
    Van der Sir says:

    Volveré a Cuba para ver a Baúl: http://internacional.elpais.co.....93658.html

    … ¡NO!

  • 69
  • 70
    geodotto says:

    Vader: Cuando derroche erótica del poder tras las elecciones ni tú te resistirás

    Es que después de ver a la de C’s ya no puedo ver otra cosa.

  • 71
    Vader says:

    El gendarme de Albacete: Este año creo que va a ir mejor lo del día del padre

    En el cole nada de nada, ya te lo digo yo. En la academia de inglés sí, ayer estuvo escogiendo fotos para hacer algo entre hoy y mañana.

    Pero la Eskuela Públika sigue en sus trece.

  • 72

    Flanker: Hay muchas tías como ésa.

    En Galicia salió una vez por tv una loca que después de medio atropellar a unos ciclistas les insultaba y les pegaba ¿no?. Es una tierra extraña, como la America profunda de Deliverance y eso.

  • 73
    Vader says:

    geodotto: C’s

    Habría que ver a la de cesss dentro de ‘veintitantos’. Es otra liga.

  • 74
    Flanker says:

    Vader: alguna predisposición genética

    Concretamente en la siguiente secuencia del ADN:

    CACAAATCACATTCTGTGAACGATAATCACAGTCACAATGTTGCCACAGACAAAGCT

  • 75

    Vader: Es otra liga.

    Son 51. Aún le dará alguna nochebuena al marido (o lo que tenga).

    Por eso tengo yo interés en ver el reportaje de Tiempo con las fotos de joven.

  • 76
    Vader says:

    El gendarme de Albacete: interés en ver el reportaje de Tiempo con las fotos de joven.

    Seeeh pero en Fans ya se sabe o sales en Disney Channel o no existes.

  • 77
    Flanker says:

    El gendarme de Albacete: En Galicia salió una vez por tv una loca

    Locas hay en todos lados, en tu tierra conocerás a una cuantas, 🙂

  • 78
    AnG-L says:

    Con los ciclistas pasa que siempre es culpa de los coches, nunca suya propia. A ver si van a ser todos clones de Mourinho.

  • 79
  • 80

    Flanker: Locas hay en todos lados,

    Jaja, mira que te pongo el trapo … pero no embistes …. antes eras más bravo, creo que te estás volviendo socialdemocrata. O peor, democristiano.

    (salud)

  • 81
    Sobibor says:

    geodotto: Es que después de ver a la de C’s ya no puedo ver otra cosa.

    Bastante mejor que la pelleja de la Cifu.

  • 82
    El Socio says:

    Perroladilla: ¿ Mi diagnóstico? Ni con un palo.

    Veo que vuelve el mariconismo al blog.

  • 83
    Erik says:

    DEP ‘Cifu’.

    «Para ti, que te gusta el Jazz».

  • 84
    Vader says:

    Joder qué manía le tenéis a la pobre mujer, parecéis de los Bukaneros.

  • 85
    Flanker says:

    Todo el que viene alguna vez a Galicia repite, excepto El Socio.

    Realmente soy socialdemócrata, qué si no.

  • 86
    Flanker says:

    Si le dáis a me gusta tampoco me voy a enfadar, 🙂

    https://www.facebook.com/VisionesDeFerrolterra

  • 87
  • 88
    Mr Bungle says:

    Muy graciosos los ciclistas, sí. Sobre todo los que van en pelotón por una cuesta a 20 por hora mientras charlan de sus cosas.
    Y luego difunden videos para recordarnos que ya es legal (eso dicen) cruzar la línea continua para adelantar a los ciclistas. Claro que sí, chavalotes, esa línea que se supone que no se debe cruzar porque se pone en zonas donde invadir el carril contrario es peligroso por falta de visibilidad, ya sean curvas cerradas o cambios de rasante.
    Vamos, que para que no se ponga en peligro el subnormal al que se le ha antojado salir a hacer el gañán en mallas cortas con la bici, te tienes que poner en peligro tú, los que van contigo en el coche y los que te puedas encontrar de frente al salir de la curva.
    Muy lógico.

    Aclaro que no he sido yo el que va disparando perdigonazos a los ciclistas…
    .. pero que me parece una idea cojonuda, vaya.

  • 89
  • 90
    Tostador says:

    El texto tiene una errata, «Acude al Vicente Calderón con tu bolsa de papelitos» cuando supongo que quieren decir papelinas.

  • 91
    AnG-L says:

    Bungle sabe.

  • 92
    El Socio says:

    Ángeles Caso candidata por Oviedo con Jodemos. Joder con la mala conciencia de los ricachos.

    http://www.elmundo.es/loc/2015.....b457e.html

  • 93
    Vader says:

    Mr Bungle: Muy graciosos los ciclistas,

    Esta mañana, en el telediario matinal, ha salido un señor mayor (ciclista) que se ha dedicado a denunciar a todos los coches que le adelantaban sin guardar la distancia de seguridad establecida.
    Se instaló una vídeo cámara en el manillar y ha emplumado a casi 50 coches.

    Qué majo.

  • 94

    Susana «Cuando se metan con Andalucía no me va a callar nadie».

    Lo acabo de oír en TD. Me resulta siempre tan chocante la desenvoltura con que los políticos españoles hablan en nombre de todo un pueblo.

  • 95
    Erik says:

    El Socio: Ángeles Caso

    Otra vieja furranca que no conoce ni dios.

    Luego ya lo de, pues culo.

  • 96

    El Socio: Ángeles Caso candidata por Oviedo

    ¿y lo de Juanjo Puigcorbé?… Tocate los cojones. Ahora sí que podemos afirmar que el movimiento independentista está de capa caída. Si por lo menos hubieran puesto a Jose Mª Pou o alguno así ….

  • 97
  • 98
    Sobibor says:

    El gendarme de Albacete: Me resulta siempre tan chocante la desenvoltura con que los políticos españoles hablan en nombre de todo un pueblo.

    Del Pujolismo al Susanismo.

  • 99
    Flanker says:

    Vader: Se instaló una vídeo cámara en el manillar y ha emplumado a casi 50 coches.

    Pues no es legar instalar una cámarita en el manillar, deberían haber emplumado a ese listorro y sancionar a los imbéciles que permitieron «esa prueba».

    https://www.youtube.com/watch?v=ewhOuX53I6w

  • 100
    Flanker says:

    El gendarme de Albacete: pero no embistes

    Para una mujer que me gusta, va y prefiere estar sola, a su aire.

    No doy más detalles, que sino pasa a ser esto un consultorio sentimental como en los viejos tiempos, 🙂

    Vendría Von Roñas como tiburón tras una manchita de sangre, la percebeira y todos los demás, 😀

    Por cierto, San Patricio, Patrón de Irlanda. Hoy toca una Guinness.

  • 101
    Vader says:

    Flanker: no es legar instalar una cámarita en el manillar

    Pues ha sido tal cual te lo cuento. No sé si la «pieza» está aún en la web de TVE.

  • 102
  • 103
    Flanker says:

    Vader: Pues ha sido tal cual te lo cuento.

    Sí, te creo, pero no es legal, increíble que eso haya ido palante.

  • 104
    Mr Bungle says:

    Me voy a poner yo con una cámara en el paso de cebra que hay en la carretera en cuesta (y qué cuesta) de mi pueblo, amagando que cruzo cada vez que se acerque un ciclista echando los higadillos.
    Que no para ni uno a dejar paso a los peatones, los muy mierdas.

  • 105
    kladik says:

    Que Ramos acaba expulsado en el Clásico es que ni cotiza, vamos.

    Hoy el Paleti tiene labor difícil. Resultado muy adverso y buenos jugadores dirigidos por un buen entrenador enfrente.
    No les queda más remedio que ir a por el partido y eso les perjudica. La espalda de Godín y de Miranda puede sufrir muchísimo si intentan presionar arriba.

    El Bayer no creo que se encierre del todo atrás más que nada porque los equipos de Roger Schmidt no saben hacer eso así que creo que harán presión a una altura media y buscarán transiciones rápidas. Supongo que será un partido loco y eso les beneficia muchísimo así que creo que marcarán uno o dos golitos y se clasificarán los germanos.

    Modo pajerosdelbalon OFF.

  • 106
    enacid says:

    Lo de Cervantes es un bluff y presagia sodomia medieval para el Domingo.

    Y como gane Podemos en Andalucía ya el acabóse ( aunque la candidata parece de esas agradecidas, yamentendéis)

  • 107
    Exiliado says:

    El Socio: Veo que vuelve el mariconismo al blog

    El mariconismo es querer follarse a supuestas mujeres que tienen cara de travelo como la Cifu o Amelie Mauresmo.

  • 108
    Flanker says:

    Ciclistas que se saltan los semáforos en rojo y no paran en los pasos de peatones (se piensan que eso no va con ellos) y son multas en toda regla; anda que no veo también a ciclistas sin el casco obligatorio y sin luces, ahora que salen más con el tiempo seco.

    Que hay conductores que pasan de todo y son unos hijosputa, por supuesto, pero mal va el ciclista que se arriesga y encima no es consciente de que el peor parado siempre será él mismo.

  • 109
    Joss says:

    AnG-L: En Everis hubo un año que por navidad regalaron bicis, y eso se veía a la legua que no valía ni para hacer arte moderno

    Yo ví por Cornellá a un moro de esos que andan por ahí recogiendo chatarra montado en una de las famosas bicis de Everis.

  • 110
    Vader says:

    Joss: Yo ví por Cornellá a un moro de esos que andan por ahí recogiendo chatarra montado en una de las famosas bicis de Everis

    Jajaja a ver si no era un Project Manager de Everis, sin más…

  • 111
    AnG-L says:

    Un project manager fuera de la oficina? Imposible. Que luego no asciende.

  • 112
    El Socio says:

    ¡¡Golpistasssss!! ¡¡Ultraderechistassssss!!

    http://www.eldiario.es/politic.....63684.html

  • 113
    Exiliado says:

    Mr Bungle: Claro que sí, chavalotes, esa línea que se supone que no se debe cruzar porque se pone en zonas donde invadir el carril contrario es peligroso por falta de visibilidad, ya sean curvas cerradas o cambios de rasante.

    Pues si viene un coche enfrente da un volantazo a la izquierda y ya está. Y luego parate y echa la marcha atras.

  • 114
    geodotto says:

    Ciclistas…
    Peores son los dueños de perros que van dejando las heces y el orín de sus canes en las aceras de Madrid.

  • 115
    Mr Bungle says:

    geodotto: Peores son los dueños de perros que van dejando las heces y el orín de sus canes en las aceras de Madrid.

    El otro día tuve que esperar pacientemente a que el golden retriever de una vieja terminase de giñar en medio de un paso de peatones para pasar yo con mi coche (un ciclista no lo habría hecho).
    Creo que si la vieja no hubiese recogido la mierda, en estos momentos os estaría escribiendo desde la cárcel, acusado de atropello y fuga.

  • 116
    Flanker says:

    geodotto: en las aceras de Madrid.

    Como si en el resto de España no fuera así.

    Desde un tiempo siempre les digo a los incívicos dueños (el perro hace lo que el dueño quiere) que si son unos miembros más de la familia, que meen y caguen en sus casas; se quedan sorprendidos, no se esperan eso.

    Aunque recojan la mierda, quedará manchada la zona, sigue siendo una guarrada. Lo de las meadas no tiene nombre, suelen orinar justo en el primer portal después de donde vive el hijoputa del dueño o de la dueña.

  • 117
    AnG-L says:

    geodotto: Ciclistas…
    Peores son los dueños de perros que van dejando las heces y el orín de sus canes en las aceras de Madrid.

    Yo estoy convencido de que son todos familia, los ciclistas, los dueños de los perros, y los perros.

  • 118
    Exiliado says:

    Flanker: Ciclistas que se saltan los semáforos en rojo y no paran en los pasos de peatones (se piensan que eso no va con ellos) y son multas en toda regla; anda que no veo también a ciclistas sin el casco obligatorio y sin luces, ahora que salen más con el tiempo seco.

    Hace unos meses. Una ciclista rodando a buena velocidad (ligera bajada) me roza cuando yo iba cruzar a al paso cebra, se salta el semaforo en rojo, cruzando una calle importante donde los coches ya estaban arrancando y tuvieron que frenarse, tras lo cual se mete en la calle que tenia enfrente y que era de direccion prohibida. Por cierto que lo de pasarse el semaforo en rojo y lo de la direccion prohibida también es un peligro para los peatones que dejan de mirar a los coches por culpa de la subnormal que esta pasando cuando ellos cruzan o porque no miran del lado prohibido. Al Gulag la mandaba yo. Un amigo mio tuvo dos costillas rotas en un choque con un ciclista.

  • 119
    El Socio says:

    AnG-L: Yo estoy convencido de que son todos familia, los ciclistas, los dueños de los perros, y los perros.

    Exkaliburismo.

  • 120
    El Socio says:

    España, mañana, será musulmana. 😀

    http://www.lavozlibre.com/noti.....-y-podemos

  • 121
    ColombianoMadridista says:

    Que a los Casillistas se les acuse de podemitas, es quizás el insulto más feo que he leído en este bloj.

    Cuando en Twitter se ve un fenómeno extrañísimo: El Moudemos.

    No es broma, que tengo a Van der sir de testigo.

  • 122
    Flanker says:

    Exiliado: tras lo cual se mete en la calle que tenia enfrente y que era de direccion prohibida

    Lástima que la selección natural no actuara ahí.

    Hay mucho retrasado y retrasado que siguen pensando que ir en bici no acarrea obligación alguna, son los que después te dicen que no sabían lo de la Ley, tampoco conocen que la ignorancia de la misma no es eximente alguna.

    A fuer de pesado (que lo soy) con el tema de conductoras, de veras que algunas, en caso de apuros por una cafrada de esas pedorras (no todas, afortundamente), te acusan a la mínima de acoso como método de defensa, lo he visto.

  • 123
    ColombianoMadridista says:

    El Socio: ¡¡Golpistasssss!! ¡¡Ultraderechistassssss!!

    Madre mía los comentarios de esa noticia.

    PERO CUÁNTO PELMAZO IZQUIERDISTA RESENTIDO HAY EN LA PUTA ESPAÑA.

    JO-DER.

  • 124
    El Socio says:

    ColombianoMadridista: Madre mía los comentarios de esa noticia.

    PERO CUÁNTO PELMAZO IZQUIERDISTA RESENTIDO HAY EN LA PUTA ESPAÑA.

    JO-DER.

    Pues algunos seguro que son casillistas jediondos.

  • 125
    ColombianoMadridista says:

    El gendarme de Albacete: Probadores, ese mundo oculto.

    Voy al baño…

  • 126
    Perroladilla says:

    El Socio: Veo que vuelve el mariconismo al blog.

    Hablas como si lo hubiese abandonado en algún momento.

  • 127
    El Socio says:

    Perroladilla: Hablas como si lo hubiese abandonado en algún momento.

    Es verdad, tú has estado siempre.

  • 128
    Perroladilla says:

    Trollombian, deja de hacerte pajotes mentales, sabes de sobra, que el Injertos y la que está a falta de una asignatura para sacarse la complejísima carrera de periodismo, esa que se folla y que vive con él, son votantes de Podemos, pero de libro.

  • 129
    ColombianoMadridista says:

    El que no se follaría a la Cifuentes es maricón perdío, o es muy muy antitatuajes (Lo que lo dejaría en amanerao).

    Lo mismo se aplica para la Cher Lloyd.

  • 130
    Perroladilla says:

    El Socio: Es verdad, tú has estado siempre.

    No te engañes, como hace Trollombian con nuestro Topillo, la homosexualidad es algo inherente, consustancial, propio, egosintónico, estructural, parte del ADN de Fans.

  • 131
  • 132
    El Socio says:

    El gendarme de Albacete: ¿y lo de Juanjo Puigcorbé?

    Castrar.

  • 133
    Perroladilla says:

    ColombianoMadridista:
    El que no se follaría a la Cifuentes es maricón perdío, o es muy muy antitatuajes (Lo que lo dejaría en amanerao).

    Aparte de cara de travelo, la Cifuentes gasta tatuajes, modifico mi diagnóstico de antes a ni con un puntero laser.

  • 134
    Flanker says:

    Potemos nunca llegará a gobernar en el plano estatal. Como mucho ahí les servirán a los sociatas para gobernar, teniendo que ceder ante los comunistas en puntos críticos, con lo cual la P€$O€ se hundirá todavía más.

    Si el Coletas y su piara llegan a gobernar, será en CC.AA. y en Hay Untamientos, eso sí, los dejarán tan laminados que se quedarán para siempre como un partido residual.

    Hay más alternativas que el PP$O€, partidos de los que se está nutriendo Pablemos.

  • 135
    Van der Sir says:

    ColombianoMadridista: Cuando en Twitter se ve un fenómeno extrañísimo: El Moudemos.

    «Pablo Iglesias, el Mauriño de la política española»

    Como diría Estadístico: Hay que joderse.

  • 136
    Van der Sir says:

    ColombianoMadridista: o es muy muy antitatuajes (Lo que lo dejaría en amanerao).

    Los tatuajes son un puto asco y las zorritas que los llevan unas sucias. Opinión, no informació.

  • 137
    Perroladilla says:

    Van der Sir: Los tatuajes son un puto asco y las zorritas que los llevan unas sucias. Opinión, no informació.

    Y trasmisoras de todo tipo de ETS, a ver cuando una universidad seria de los USA, hace un estudio pormenorizado entre la falta de higiene y los tatuajes.

  • 138
    AnG-L says:

    Van der Sir: “Pablo Iglesias, el Mauriño de la política española”

    THIS 😀

  • 139
    Flanker says:

    «Si eres joven, fuerte y saludable, escríbeme un mensaje. Mi madre será la encargada de seleccionar a los candidatos y anunciará al ganador. Ella sabe lo que necesito».

    http://www.abc.es/estilo/gente.....inkname=CM

    Tu madre sabe muy bien lo que necesitas, tú también.

    https://www.youtube.com/watch?v=I8P80A8vy9I

  • 140
    AnG-L says:

    Flanker: Si eres joven, fuerte y saludable, escríbeme un mensaje. Mi madre será la encargada de seleccionar a los candidatos y anunciará al ganador.

    Corre flanker, escribe. A lo mejor ganas!

  • 141
    Flanker says:

    AnG-L: Corre flanker, escribe. A lo mejor ganas!

    Allá voy.

    Madrid, TRIUNFO.

  • 142
    El Socio says:

    Flanker: el plano estatal

    ¿Por qué no dices nacional, hijo de perra? ¿Eres marxista?

  • 143
    AnG-L says:

    El Socio: hijo de perra

    ¿Flanker es ciclista?

  • 144
  • 145
    Perroladilla says:

    Me ha dado un pálpito, el City se folla a la Farsa, aquí lo dejo escrito.

    El Socio: ¿Eres marxista?

    Yo me lo imagino más troskista, en plan Monedero, no sé porqué.

  • 146
    elcubano says:

    Perroladilla: Me ha dado un pálpito, el City se folla a la Farsa, aquí lo dejo, escrito.

    Tranquilo, Pellegrini a tomado buena nota.

  • 147
    AnG-L says:

    elcubano: Pellegrini a tomado buena nota.

    Otro que tiene un Xiaomi…

  • 148
    Kojiro Hyuga says:

    Creo que lo que quiere decir el Tata es que por mucho que rotes a los jugadores, en los partidos importantes pones a los buenos porque no hay cojones para otra cosa y el jugador se da cuenta automáticamente, no que un jugador le diga el equipo que tiene que poner. Que igual pasó también, pero lo que quiere decir ahí es lo otro.

  • 149
    Perroladilla says:

    El Barsa está dominado, por el engendro con sindrome de down hormonado, y al chaval, un partido de mierda contra Pellegrini, no le pone y menos aun si tenemos en cuenta que en unos días se enfrenta al club más glorioso que ha visto la humanidad, por lo que la desmotivación de Hormoneitor, se va a contagiar al resto de la plantilla, que quitando a Neymar y Luis Suárez, es ya de por sí, una pedazo de mierda ¿Consecuencia? el City se folla al Barsa a pesar de su entrenador.

    Recordad mis palabras, mañana os las pienso restregar por vuestras tristes jetas.

  • 150
    madridsXXI says:

    Con el tema de los ciclistas se confirman mis sospechas de que tenéis completo pánico, aversión, terror insuperable a cualquier cosa que tenga que ver con el deporte real, el de sudar. Cosa bastante rara teniendo en cuenta la cantidad de tiempo que dedicáis a hablar de deporte.

    Y después criticáis de Cocoliso.

  • 151
    ZIZOU_DIOS says:

    Temo lo que pueda ocurrir si algun dia un miembro de la sociedad profetica mikista dice que «el sol sale por el este y se pone por el oeste» o «2 y 2 son 4»

  • 152
    AnG-L says:

    madridsXXI: tenéis completo pánico, aversión, terror insuperable a cualquier cosa que tenga que ver con el deporte real, el de sudar.

    Te reto a cualquier deporte que quieras. Después chorrearte, procederé a cagarme en todos y cada uno de los practicantes de dicho deporte, llamándoles inútiles y maricones.

  • 153
    ZIZOU_DIOS says:

    De hecho algun antepasado de Miki debio decir «t_d_s p_t_s» y desde entonces asi nos va en el tema sesuarl.

  • 154
    Sobibor says:

    El Socio: ¿Por qué no dices nacional, hijo de perra? ¿Eres marxista?

    Bueno, los comunistas son muy patriotas y muy antiimperialistas (siempre que no sean españoles), ojo ahí.

  • 155
    madridsXXI says:

    Perroladilla: Recordad mis palabras, mañana os las pienso restregar por vuestras tristes jetas.

    Joder, a ver si es cierto. Aunque el poder perdedor de Pelle es grande, casi imposible de superar.

  • 156
    madridsXXI says:

    AnG-L: Te reto a cualquier deporte que quieras.

    A cualquiera en el que no haya que gastarse más de 100 euros en material, ¿no?.

  • 157
  • 158
    AnG-L says:

    madridsXXI: A cualquiera en el que no haya que gastarse más de 100 euros en material, ¿no?.

    Tú te puedes gastar lo que quieras. Yo con la gama más baja de la peor tienda, te peto. Menos en el tenis, que sí me dejé en su momento un buen dinero en la raqueta (y que por supuesto con la más barata del decathlon juego mejor).

  • 159
    madridsXXI says:

    AnG-L: Yo con la gama más baja de la peor tienda, te peto

    En alguno en particular estoy casi seguro de que no, pero soy una persona que cree en la gente y me gustaría pensar que eres un atleta y que en la mayoría de deportes tienes un rendimiento superior a la media, y que por tanto no eres un puto farsante que va presumiendo por Internet de cosas que sabe que son prácticamente indemostrables.

    Así que vale, te creo.

    Ahora bien, todo esto venía porque el comentario de que por encima de 500 euros es una gilipollez gastar en bicis demuestra que no tienes ni puta idea de bicicletas, y que vas pontificando sin saber nada. Yo tampoco soy un hesxpertho, pero salgo de vez en cuando con bici de montaña, y solamente saliendo un par de veces te das cuenta de que por caminos sin asfaltar, sin meterte por nada difícil, las bicis de 200 pavos se descoyuntan enteras, los cambios se descentran, la cadena se sale ante cualquier bache, empiezan a hacer ruidos y te duran dos salidas. Es algo tan evidente que cualquiera que haya salido alguna vez lo sabe.

    Aunque si la quieres para pasear por un parque a diez por hora intentando parecer alguien normal y pillar cacho entre las mamis que sacan a los niños a tomar el sol, entonces sí, no te gastes más pelas.

  • 160
    AnG-L says:

    madridsXXI: las bicis de 200 pavos se descoyuntan enteras, los cambios se descentran, la cadena se sale ante cualquier bache, empiezan a hacer ruidos y te duran dos salidas. Es algo tan evidente que cualquiera que haya salido alguna vez lo sabe.

    Eso es tan cierto como que Mourinho es el entrenador que mejor lo ha hecho en el real madrid.

  • 161
    AnG-L says:

    madridsXXI: En alguno en particular estoy casi seguro de que no

    Golf y Ajedrez no son deportes. Que ahí sí que me gana hasta el más tonto. Bueno, al golf nunca he jugado, a lo mejor soy un talento natural, pero no creo.

  • 162
    madridsXXI says:

    AnG-L: Eso es tan cierto como que Mourinho es el entrenador que mejor lo ha hecho en el real madrid.

    Ahí estamos de acuerdo.

  • 163
    ZIZOU_DIOS says:

    Me puede explicar el señor paquetorres a que partidos grandes del paleti iba cuando era pequeño?

    Al derbi contra el Racing de Motilla del Palancar?

    http://tinyurl.com/lwt7s2v

  • 164

    Te reto a cualquier deporte que quieras. /// ¿Rugby quizás?

  • 165
    Van der Sir says:

    Blue: ¡¡¡ El MARCA dando lecciones a la BBC !!!

    La BBC sigue destapando las vergüenzas de Marca: https://twitter.com/BBCSport/status/577405667197128704

  • 166
    Plutarco says:

    El patético hoy lo tiene en chino para ganar la clasificación. Se las prometían muy felices con la llegada de Paquetorres al equipo y andaban dando lecciones de lo guay que eran y de lo que iban a conseguir y tal.
    Así, después de lograr su cuasi único objetivo de ganar al Madrí, vaciaron de contenido su existencia y sus cabezas de chorlito hicieron el resto. Ahora cabalgan ya cuartos después de palmar sus últimos partidos en liga y se han eliminado de la competición. Sólo les queda hoy para seguir en la brecha pero su recua de picapedreros ya no da para más.

    Su cacareada victoria les eliminó indirectamente del resto de partidos y el cholismo ya toca inevitablemente a su fin. Lo tenéis merecido. ¡A la puta calle!

  • 167
    AnG-L says:

    Enelfondohaysitio: ¿Rugby quizás?

    Por ejemplo. Pero 1 vs 1 al rugby puede ser un poco coñazo.

  • 168
    AnG-L says:

    Hablando de ciclistas, habría que sacrificar a absolutamente todos los que llevan a sus hijos bebés en una sillita en la bici.

  • 169
    AnG-L says:

    Moyá lesionado. Me cae bien, pero el chico está hecho de la misma pasta que Khedira.

  • 170
    Mr Bungle says:

    Yo, que le tenía bastante respeto a MadridSXXI, ahora cada vez que se ponga todo campanudo a hablar de algo me lo imaginaré con su atuendo de los domingos, las mallas, el casco de Calimero y el maillot embotando la barriga cervecera y así no puedo, no puedo.

  • 171
    Mr Bungle says:

    Joder, le he ido a echar un vistazo al partido del Paleti y con toda la mierda y papeles que han tirado, y los jugadores con pinta de toxicómanos, hay que reconocer que han logrado transmitir a la perfección a toda Europa la imagen de suburbio que siempre ha ido ligada a sus valores.

  • 172
    Tio Lucas says:

    Plutarco es otro que se está mikinguizando a pasos gigantes. O frenamos ésto o no habrá esperanza para nadie.

  • 173
    AnG-L says:

    Al 24 ese del atleti de dónde lo han sacado? A su lado Cassano tiene cuerpo de bailarina.

  • 174
    El Socio says:

    Mr Bungle:
    Yo, que le tenía bastante respeto a MadridSXXI, ahora cada vez que se ponga todo campanudo a hablar de algo me lo imaginaré con su atuendo de los domingos, las mallas, el casco de Calimero y el maillot embotando la barriga cervecera y así no puedo, no puedo.

    Peor era lo de Rumbakalao.

  • 175
    Perroladilla says:

    Mr Bungle:
    lo imaginaré con su atuendo de los domingos, las mallas, el casco de Calimero y el maillot embotando la barriga

    Y empezaras a tocarte, no nos digas más.

  • 176
    amo a ducadam says:

    Pos yo le he metido 50 aurelios a que se clasifican los asesinos del cornudo.

  • 177
    El Socio says:

    Oye, pues está bien ver el partido por la web de RTVE. Puedes escoger cámara, ¡¡y no oyes a Rivero!!

  • 178
    Perroladilla says:

    El peinado de Griezzman, debe arrasar entre todos los politoxicomanos homosexuales de los suburbios gitanos de toda de Europa.

  • 179
    Perroladilla says:

    Sale Paquetorres, vuelve la ilusión.

  • 180
    Plutarco says:

    Tio Lucas: Plutarco es otro que se está mikinguizando a pasos gigantes. O frenamos ésto o no habrá esperanza para nadie.

    Jajaja. Arteras Insidiash.

    Aún fallando el de hoy llevo un porcentaje del 92´45% de vaticinios acertados. El puntaje.
    Además yo siempre fui más de tu idolatrado Basilio.

  • 181
    El Socio says:

    El Farsenal casi lo consigue, pero a la puta calle.

  • 182

    Por ejemplo. Pero 1 vs 1 al rugby puede ser un poco coñazo. // busque a 14 que yo ya tengo a los míos.

  • 183
    Tio Lucas says:

    Plutarco: Aún fallando el de hoy llevo un porcentaje del 92´45% de vaticinios acertados

    ¿Lo ves? Ya hasta te defiendes igual que él.

  • 184

    Pues yo iba a ver los penales, pero no se me ve nada en la web de TV1.

  • 185
    Miki el Mikingo says:

    Pródromo: el Mono Burgos explicando en la pizarra a su equipo la estrategia para la tanda de penalties. (Jajaja… Patéticos)

  • 186
    Miki el Mikingo says:

    Se mashca la trajedya

  • 187
    Miki el Mikingo says:

    Lo estoy viendo: los del Patético, todos cañonazos con los ojos cerrados

  • 188

    Hay cosas que me cabrean inmediatamente.

    http://www.i-ambiente.es/?q=no.....rgia-solar

    (en esto igual coincidía con Mandinga, mira) (aunque supongo que habrá que leer todo el texto) (pero eso de que los rayos del sol sean también del Estado)

  • 189
    Flanker says:

    Vaya panda, fallos en el primero.

  • 190
    Miki el Mikingo says:

    Las caras del público, un poema. Patetismo en estado puro.

  • 191
    Miki el Mikingo says:

    Muchas risas: va ganando el Patético en los penars.

    Esto cumple todos los criterios de derrota Épyca del Patético

  • 192
    Miki el Mikingo says:

    El moro del Patético rezando cara a Murcia… tintes surrealistas, por momento.

  • 193
    Flanker says:

    Mandril-Paleti.

    Acabaremos con ellos.

  • 194
    Miki el Mikingo says:

    «Si falla el alemán, nos vamos a cuartos»… pues se fueron.

    Jajaja… Patéticos

  • 195
    Miki el Mikingo says:

    Lágrimas, abrazos, sudor, sangre, polvo, heces… «¡Que vote el Calderón, que vote el Calderón!»

    ¡¡¡Pero si sólo han pasado de Octavos, y de milagro!!!

    (Jajaja… Patéticos)

    ((Mi oreja -la izquierda- va a ser planchada por mí en los próximos minutos.))

  • 196
    entibia says:

    Ha tenido que llegar el gafe Mikingo a salvar a los patéticos.

    Ni en pintura los quiero. Anchelotto nightmare.

  • 197
    kladik says:

    Yo sólo le pido a diosito que no nos toquen a nosotros.

  • 198
  • 199

    Vidas de santos y personas ejemplares.

    http://www.playgroundmag.net/n.....50001.html

    (mañana más. Chao)

  • 200
    elcubano says:

    ¿Bueno, entonces Carletto se pide al Pateti? A ver que tal la flor.

  • 201
    ZIZOU_DIOS says:

    Supongo que habra alguna (estupida) razon por la que es algo que debemos HODIAR, pero…

    viva san patricio!!!

  • 202
    El Socio says:

    ZIZOU_DIOS: viva san patricio!!!

    ¿Por qué? ¿Qué es tuyo?

  • 203
    Erik says:

    El Socio: ¿Por qué? ¿Qué es tuyo?

    Se refiere a la festividad, onvre.

    Una excusa para salir a libar cerveza, intentar superar a los irlandeses (tendría que ir yo y hablar de güisqui, y espérate, juas), buen rollo… y muchas zorritas dispuestas (según me cuentan) por Madrid.

    Divertido.

    Del Santo… es el Patrón de Irlanda (junto con ¿Santa Brígida?). Cristiano, como la vieja Europa, como todos nosotros: bautizados.

    Me seguiré cagando en los putos ‘Moros Locos’. Aunque la Cruzada 2.CULO sea una puta mierda política: EXTERMINAR.

    El jipi tenía razón. Igual es que soy un…

    😉

  • 204
    Erik says:

    elcubano: ¿Bueno, entonces Carletto se pide al Pateti? A ver que tal la flor.

    Me la sudan ambos.

    Uno por gilipollas cobarde y los otros por ser basura.

    El Madrid (muérete, Roncerdo) puede dar ¿sorpresas? esta temporada.
    También hacer el ridículo.
    La temporada es larga, yshtéricasnobs.

  • 205
    Erik says:

    Háblanos del hijo de perra de Monedero, Miki.

  • 206
    Erik says:

    Anoche resplandecía CarMilf en ECH.

    Se la están follando…

    Aunque la jaquetona estaba muy burra.

    Menos mal que llegó Pipayasi(¡), que Duro(je) andaba pidiendo enculaejecución.

  • 207
  • 208
    Erik says:

    y…

    na,ya mela

  • 209
    Erik says:

    Iron Maiden – Wasted Years.
    https://youtu.be/cOVzXYEU3Bk

  • 210
    Erik says:

    Guns N’ Roses – Use Your Illusion II [Full Album HD]
    https://youtu.be/iiZ_RAS8v-M

    ………………..

  • 211
    Erik says:

    A mí sí que me pica la polla, me cago en dios.

    Hale, a seguir mierdeando con el puto clásico y su puta madre.

    Al peo.

    Crípticos siempre… jejeje, me hizo gracia.

  • 212
    El Socio says:

    Trada nueva.

Deja un comentario

Tienes que iniciar sesión para escribir un comentario.